Review



random hexamers  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    New England Biolabs random hexamers
    Random Hexamers, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 436 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hexamer+primer/Random+Primer+6/pmc12875486-304-33-35
    Average 94 stars, based on 436 article reviews
    random hexamers - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: Disease-linked TDP-43 hyperphosphorylation suppresses TDP-43 condensation and aggregation
    Article Snippet: .. 48h after transfection, cells were harvested and total RNA was extracted using an RNeasy mini kit from Qiagen. cDNA was synthesized using 500 ng of total RNA, M-MLV reverse transcriptase polymerase (Invitrogen), and 6 μM of random hexamer primer (NEB). cDNA was amplified with Taq DNA polymerase (NEB) using the forward (FW) and reverse (RV) primers targeting the SKAR gene (FW - 5’CCTTCATAAACCCACCCATTGGGACAG3’; RV-5’GTGGTGGAGAAAGCCGCCTGAG3’) ( ) and the BIM gene (FW-5’TCTGAGTGTGACCGAGAAGG3’; RV - 5’TCTTGGGCGATCCATATCTC 3’) ( ). .. PCR products were separated by electrophoresis on a 2.5% agarose gel containing GelRed (Sigma).

    Article Title: Disease‐linked TDP‐43 hyperphosphorylation suppresses TDP‐43 condensation and aggregation
    Article Snippet: .. 48 h after transfection, cells were harvested and total RNA was extracted using an RNeasy mini kit from Qiagen. cDNA was synthesized using 500 ng of total RNA, M‐MLV reverse transcriptase polymerase (Invitrogen), and 6 μM of random hexamer primer (NEB). cDNA was amplified with Taq DNA polymerase (NEB) using the forward (FW) and reverse (RV) primers targeting the SKAR gene (FW—5′CCTTCATAAACCCACCCATTGGGACAG3′; RV—5′GTGGTGGAGAAAGCCGCCTGAG3′) (Fiesel et al , ) and the BIM gene (FW—5′TCTGAGTGTGACCGAGAAGG3′; RV—5′TCTTGGGCGATCCATATCTC 3′) (Tollervey et al , ). .. PCR products were separated by electrophoresis on a 2.5% agarose gel containing GelRed (Sigma).

    Synthesized:

    Article Title: Disease-linked TDP-43 hyperphosphorylation suppresses TDP-43 condensation and aggregation
    Article Snippet: .. 48h after transfection, cells were harvested and total RNA was extracted using an RNeasy mini kit from Qiagen. cDNA was synthesized using 500 ng of total RNA, M-MLV reverse transcriptase polymerase (Invitrogen), and 6 μM of random hexamer primer (NEB). cDNA was amplified with Taq DNA polymerase (NEB) using the forward (FW) and reverse (RV) primers targeting the SKAR gene (FW - 5’CCTTCATAAACCCACCCATTGGGACAG3’; RV-5’GTGGTGGAGAAAGCCGCCTGAG3’) ( ) and the BIM gene (FW-5’TCTGAGTGTGACCGAGAAGG3’; RV - 5’TCTTGGGCGATCCATATCTC 3’) ( ). .. PCR products were separated by electrophoresis on a 2.5% agarose gel containing GelRed (Sigma).

    Article Title: Disease‐linked TDP‐43 hyperphosphorylation suppresses TDP‐43 condensation and aggregation
    Article Snippet: .. 48 h after transfection, cells were harvested and total RNA was extracted using an RNeasy mini kit from Qiagen. cDNA was synthesized using 500 ng of total RNA, M‐MLV reverse transcriptase polymerase (Invitrogen), and 6 μM of random hexamer primer (NEB). cDNA was amplified with Taq DNA polymerase (NEB) using the forward (FW) and reverse (RV) primers targeting the SKAR gene (FW—5′CCTTCATAAACCCACCCATTGGGACAG3′; RV—5′GTGGTGGAGAAAGCCGCCTGAG3′) (Fiesel et al , ) and the BIM gene (FW—5′TCTGAGTGTGACCGAGAAGG3′; RV—5′TCTTGGGCGATCCATATCTC 3′) (Tollervey et al , ). .. PCR products were separated by electrophoresis on a 2.5% agarose gel containing GelRed (Sigma).

    Article Title: Molecular and clinical characteristics related to rhinovirus infection in Brasília, Brazil
    Article Snippet: .. This primer pair was used to amplify an approximately 540-bp fragment for amplicon sequencing, including part of 5’ UTR and the VP4/VP2 protein gene of HRV A, B, and C. cDNA of the selected samples were synthesized using MMLV transcriptase (Thermo Fisher Scientific, Waltham, USA) with random hexamer primer and, then, amplified with LongAmp Taq DNA Polymerase (New England BioLabs, Ipswich, USA). .. The PCR product was purified and sequenced by the Sanger method at Macrogen Inc. (Seoul, South Korea).

    Reverse Transcription:

    Article Title: Disease-linked TDP-43 hyperphosphorylation suppresses TDP-43 condensation and aggregation
    Article Snippet: .. 48h after transfection, cells were harvested and total RNA was extracted using an RNeasy mini kit from Qiagen. cDNA was synthesized using 500 ng of total RNA, M-MLV reverse transcriptase polymerase (Invitrogen), and 6 μM of random hexamer primer (NEB). cDNA was amplified with Taq DNA polymerase (NEB) using the forward (FW) and reverse (RV) primers targeting the SKAR gene (FW - 5’CCTTCATAAACCCACCCATTGGGACAG3’; RV-5’GTGGTGGAGAAAGCCGCCTGAG3’) ( ) and the BIM gene (FW-5’TCTGAGTGTGACCGAGAAGG3’; RV - 5’TCTTGGGCGATCCATATCTC 3’) ( ). .. PCR products were separated by electrophoresis on a 2.5% agarose gel containing GelRed (Sigma).

    Article Title: Nonsense‐mediated decay factor SMG7 sensitizes cells to TNFα‐induced apoptosis via CYLD tumor suppressor and the noncoding oncogene Pvt1
    Article Snippet: .. Total RNA was isolated using InviTrap Spin Cell RNA Mini Kit (Stratec, Birkenfeld, Germany), and 500 ng RNA was used for first‐strand cDNA synthesis via random hexamer primer and AMV Reverse Transcriptase (NEB, Ipswich, MA, USA) following the manufacturer's instructions. .. The qPCR was carried out on a LightCycler 480 (Roche, Basel, Switzerland) using Power SYBR Green PCR Master Mix (Thermo Fisher Scientific).

    Article Title: Disease‐linked TDP‐43 hyperphosphorylation suppresses TDP‐43 condensation and aggregation
    Article Snippet: .. 48 h after transfection, cells were harvested and total RNA was extracted using an RNeasy mini kit from Qiagen. cDNA was synthesized using 500 ng of total RNA, M‐MLV reverse transcriptase polymerase (Invitrogen), and 6 μM of random hexamer primer (NEB). cDNA was amplified with Taq DNA polymerase (NEB) using the forward (FW) and reverse (RV) primers targeting the SKAR gene (FW—5′CCTTCATAAACCCACCCATTGGGACAG3′; RV—5′GTGGTGGAGAAAGCCGCCTGAG3′) (Fiesel et al , ) and the BIM gene (FW—5′TCTGAGTGTGACCGAGAAGG3′; RV—5′TCTTGGGCGATCCATATCTC 3′) (Tollervey et al , ). .. PCR products were separated by electrophoresis on a 2.5% agarose gel containing GelRed (Sigma).

    Article Title: Detection and Molecular Characterization of GI-1 and GI-23 Avian Infectious Bronchitis Virus in Broilers Indicate the Emergence of New Genotypes in Bolivia
    Article Snippet: .. For cDNA synthesis, 7 μL of total RNA (300 ng) from each sample and 2 μL of random hexamer primer (New England Biolabs, Ipswich, MA, USA) were subjected to reverse transcription using ProtoScript ® II Reverse Transcriptase (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol. .. Subsequently, the full S1 gene was amplified using a reaction mixture containing 10 μL of Phusion Hot Start II High-Fidelity PCR Master Mix (1x) (Thermo Scientific, Waltham, MA, USA), 1 μL of forward primer (5′-TGAAACTGAACAAAAGAC-3′) (10 pmol/μL), 1 μL of reverse primer (5′-CCATAAGTAACATAAGGRCRA-3′) (10 pmol/μL) [ ], 0.6 μL of DMSO, and 2 μL of cDNA in a final volume of 20 μL.

    Article Title: Viral Metagenomics Revealed a Novel Cardiovirus in Feces of Wild Rats.
    Article Snippet: Background/Aims: Cardiovirus is a genus of viruses belonging to the family Picornaviridae.. Here, we used viral metagenomic techniques to detect the viral nucleic acid in the fecal samples from wild rats in Zhenjiang city in China.. Method: Fecal samples were collected from 20 wild rats and pooled into four sample pools and then subjected to libraries construction which were then sequenced on Illumina MiSeq platform.

    Random Hexamer:

    Article Title: Disease-linked TDP-43 hyperphosphorylation suppresses TDP-43 condensation and aggregation
    Article Snippet: .. 48h after transfection, cells were harvested and total RNA was extracted using an RNeasy mini kit from Qiagen. cDNA was synthesized using 500 ng of total RNA, M-MLV reverse transcriptase polymerase (Invitrogen), and 6 μM of random hexamer primer (NEB). cDNA was amplified with Taq DNA polymerase (NEB) using the forward (FW) and reverse (RV) primers targeting the SKAR gene (FW - 5’CCTTCATAAACCCACCCATTGGGACAG3’; RV-5’GTGGTGGAGAAAGCCGCCTGAG3’) ( ) and the BIM gene (FW-5’TCTGAGTGTGACCGAGAAGG3’; RV - 5’TCTTGGGCGATCCATATCTC 3’) ( ). .. PCR products were separated by electrophoresis on a 2.5% agarose gel containing GelRed (Sigma).

    Article Title: Nonsense‐mediated decay factor SMG7 sensitizes cells to TNFα‐induced apoptosis via CYLD tumor suppressor and the noncoding oncogene Pvt1
    Article Snippet: .. Total RNA was isolated using InviTrap Spin Cell RNA Mini Kit (Stratec, Birkenfeld, Germany), and 500 ng RNA was used for first‐strand cDNA synthesis via random hexamer primer and AMV Reverse Transcriptase (NEB, Ipswich, MA, USA) following the manufacturer's instructions. .. The qPCR was carried out on a LightCycler 480 (Roche, Basel, Switzerland) using Power SYBR Green PCR Master Mix (Thermo Fisher Scientific).

    Article Title: Disease‐linked TDP‐43 hyperphosphorylation suppresses TDP‐43 condensation and aggregation
    Article Snippet: .. 48 h after transfection, cells were harvested and total RNA was extracted using an RNeasy mini kit from Qiagen. cDNA was synthesized using 500 ng of total RNA, M‐MLV reverse transcriptase polymerase (Invitrogen), and 6 μM of random hexamer primer (NEB). cDNA was amplified with Taq DNA polymerase (NEB) using the forward (FW) and reverse (RV) primers targeting the SKAR gene (FW—5′CCTTCATAAACCCACCCATTGGGACAG3′; RV—5′GTGGTGGAGAAAGCCGCCTGAG3′) (Fiesel et al , ) and the BIM gene (FW—5′TCTGAGTGTGACCGAGAAGG3′; RV—5′TCTTGGGCGATCCATATCTC 3′) (Tollervey et al , ). .. PCR products were separated by electrophoresis on a 2.5% agarose gel containing GelRed (Sigma).

    Article Title: Full-length transcriptome sequences of ephemeral plant Arabidopsis pumila provides insight into gene expression dynamics during continuous salt stress
    Article Snippet: Sequencing libraries were generated using a NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB) following the manufacturer’s recommendations, and index codes were added to attribute sequences to each sample. .. In brief, mRNA was purified from total RNA using poly-T oligo-attached magnetic beads, fragmented and used for cDNA synthesis with random hexamer primer (NEB). .. After end repair, adenylation, adapter ligation, cDNA purification, and PCR amplification, 21 paired-end cDNA libraries were constructed, and their qualities assessed on the Agilent Bioanalyzer 2100 system.

    Article Title: Detection and Molecular Characterization of GI-1 and GI-23 Avian Infectious Bronchitis Virus in Broilers Indicate the Emergence of New Genotypes in Bolivia
    Article Snippet: .. For cDNA synthesis, 7 μL of total RNA (300 ng) from each sample and 2 μL of random hexamer primer (New England Biolabs, Ipswich, MA, USA) were subjected to reverse transcription using ProtoScript ® II Reverse Transcriptase (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol. .. Subsequently, the full S1 gene was amplified using a reaction mixture containing 10 μL of Phusion Hot Start II High-Fidelity PCR Master Mix (1x) (Thermo Scientific, Waltham, MA, USA), 1 μL of forward primer (5′-TGAAACTGAACAAAAGAC-3′) (10 pmol/μL), 1 μL of reverse primer (5′-CCATAAGTAACATAAGGRCRA-3′) (10 pmol/μL) [ ], 0.6 μL of DMSO, and 2 μL of cDNA in a final volume of 20 μL.

    Article Title: The regulatory architecture of the primed pluripotent cell state
    Article Snippet: The eluted sample was further purified using AMPure XP PCR purification beads (Beckman Coulter A63880) at a 1:1 sample to bead ratio, and eluted with 15 μl of nuclease-free water. .. For second-strand synthesis, 1 μl of 10 mM dNTPs and 1 μl of 100 mM adapter-linked random hexamer primer were added, followed by heating at 70°C for 2 min and immediate cooling on ice for 5 min. 2 μl of NEBuffer 2 (New England Biolabs B7002) and 1 μl of Klenow large fragment DNA polymerase (New England Biolabs M0210) were then added, followed by incubation at 25 degrees for 30 min and two rounds of purification with AMPure XP beads. .. The double-stranded cDNA was eluted into 15 μl nuclease-free water and concentration measured using a Qubit Fluorometer 3.0 with dsDNA high-sensitivity assay kit (ThermoFisher Q32851).

    Article Title: Viral Metagenomics Revealed a Novel Cardiovirus in Feces of Wild Rats.
    Article Snippet: Background/Aims: Cardiovirus is a genus of viruses belonging to the family Picornaviridae.. Here, we used viral metagenomic techniques to detect the viral nucleic acid in the fecal samples from wild rats in Zhenjiang city in China.. Method: Fecal samples were collected from 20 wild rats and pooled into four sample pools and then subjected to libraries construction which were then sequenced on Illumina MiSeq platform.

    Article Title: Molecular and clinical characteristics related to rhinovirus infection in Brasília, Brazil
    Article Snippet: .. This primer pair was used to amplify an approximately 540-bp fragment for amplicon sequencing, including part of 5’ UTR and the VP4/VP2 protein gene of HRV A, B, and C. cDNA of the selected samples were synthesized using MMLV transcriptase (Thermo Fisher Scientific, Waltham, USA) with random hexamer primer and, then, amplified with LongAmp Taq DNA Polymerase (New England BioLabs, Ipswich, USA). .. The PCR product was purified and sequenced by the Sanger method at Macrogen Inc. (Seoul, South Korea).

    Amplification:

    Article Title: Disease-linked TDP-43 hyperphosphorylation suppresses TDP-43 condensation and aggregation
    Article Snippet: .. 48h after transfection, cells were harvested and total RNA was extracted using an RNeasy mini kit from Qiagen. cDNA was synthesized using 500 ng of total RNA, M-MLV reverse transcriptase polymerase (Invitrogen), and 6 μM of random hexamer primer (NEB). cDNA was amplified with Taq DNA polymerase (NEB) using the forward (FW) and reverse (RV) primers targeting the SKAR gene (FW - 5’CCTTCATAAACCCACCCATTGGGACAG3’; RV-5’GTGGTGGAGAAAGCCGCCTGAG3’) ( ) and the BIM gene (FW-5’TCTGAGTGTGACCGAGAAGG3’; RV - 5’TCTTGGGCGATCCATATCTC 3’) ( ). .. PCR products were separated by electrophoresis on a 2.5% agarose gel containing GelRed (Sigma).

    Article Title: Disease‐linked TDP‐43 hyperphosphorylation suppresses TDP‐43 condensation and aggregation
    Article Snippet: .. 48 h after transfection, cells were harvested and total RNA was extracted using an RNeasy mini kit from Qiagen. cDNA was synthesized using 500 ng of total RNA, M‐MLV reverse transcriptase polymerase (Invitrogen), and 6 μM of random hexamer primer (NEB). cDNA was amplified with Taq DNA polymerase (NEB) using the forward (FW) and reverse (RV) primers targeting the SKAR gene (FW—5′CCTTCATAAACCCACCCATTGGGACAG3′; RV—5′GTGGTGGAGAAAGCCGCCTGAG3′) (Fiesel et al , ) and the BIM gene (FW—5′TCTGAGTGTGACCGAGAAGG3′; RV—5′TCTTGGGCGATCCATATCTC 3′) (Tollervey et al , ). .. PCR products were separated by electrophoresis on a 2.5% agarose gel containing GelRed (Sigma).

    Article Title: Molecular and clinical characteristics related to rhinovirus infection in Brasília, Brazil
    Article Snippet: .. This primer pair was used to amplify an approximately 540-bp fragment for amplicon sequencing, including part of 5’ UTR and the VP4/VP2 protein gene of HRV A, B, and C. cDNA of the selected samples were synthesized using MMLV transcriptase (Thermo Fisher Scientific, Waltham, USA) with random hexamer primer and, then, amplified with LongAmp Taq DNA Polymerase (New England BioLabs, Ipswich, USA). .. The PCR product was purified and sequenced by the Sanger method at Macrogen Inc. (Seoul, South Korea).

    Isolation:

    Article Title: Nonsense‐mediated decay factor SMG7 sensitizes cells to TNFα‐induced apoptosis via CYLD tumor suppressor and the noncoding oncogene Pvt1
    Article Snippet: .. Total RNA was isolated using InviTrap Spin Cell RNA Mini Kit (Stratec, Birkenfeld, Germany), and 500 ng RNA was used for first‐strand cDNA synthesis via random hexamer primer and AMV Reverse Transcriptase (NEB, Ipswich, MA, USA) following the manufacturer's instructions. .. The qPCR was carried out on a LightCycler 480 (Roche, Basel, Switzerland) using Power SYBR Green PCR Master Mix (Thermo Fisher Scientific).

    cDNA Synthesis:

    Article Title: Nonsense‐mediated decay factor SMG7 sensitizes cells to TNFα‐induced apoptosis via CYLD tumor suppressor and the noncoding oncogene Pvt1
    Article Snippet: .. Total RNA was isolated using InviTrap Spin Cell RNA Mini Kit (Stratec, Birkenfeld, Germany), and 500 ng RNA was used for first‐strand cDNA synthesis via random hexamer primer and AMV Reverse Transcriptase (NEB, Ipswich, MA, USA) following the manufacturer's instructions. .. The qPCR was carried out on a LightCycler 480 (Roche, Basel, Switzerland) using Power SYBR Green PCR Master Mix (Thermo Fisher Scientific).

    Article Title: Full-length transcriptome sequences of ephemeral plant Arabidopsis pumila provides insight into gene expression dynamics during continuous salt stress
    Article Snippet: Sequencing libraries were generated using a NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB) following the manufacturer’s recommendations, and index codes were added to attribute sequences to each sample. .. In brief, mRNA was purified from total RNA using poly-T oligo-attached magnetic beads, fragmented and used for cDNA synthesis with random hexamer primer (NEB). .. After end repair, adenylation, adapter ligation, cDNA purification, and PCR amplification, 21 paired-end cDNA libraries were constructed, and their qualities assessed on the Agilent Bioanalyzer 2100 system.

    Article Title: Detection and Molecular Characterization of GI-1 and GI-23 Avian Infectious Bronchitis Virus in Broilers Indicate the Emergence of New Genotypes in Bolivia
    Article Snippet: .. For cDNA synthesis, 7 μL of total RNA (300 ng) from each sample and 2 μL of random hexamer primer (New England Biolabs, Ipswich, MA, USA) were subjected to reverse transcription using ProtoScript ® II Reverse Transcriptase (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol. .. Subsequently, the full S1 gene was amplified using a reaction mixture containing 10 μL of Phusion Hot Start II High-Fidelity PCR Master Mix (1x) (Thermo Scientific, Waltham, MA, USA), 1 μL of forward primer (5′-TGAAACTGAACAAAAGAC-3′) (10 pmol/μL), 1 μL of reverse primer (5′-CCATAAGTAACATAAGGRCRA-3′) (10 pmol/μL) [ ], 0.6 μL of DMSO, and 2 μL of cDNA in a final volume of 20 μL.

    Purification:

    Article Title: Full-length transcriptome sequences of ephemeral plant Arabidopsis pumila provides insight into gene expression dynamics during continuous salt stress
    Article Snippet: Sequencing libraries were generated using a NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB) following the manufacturer’s recommendations, and index codes were added to attribute sequences to each sample. .. In brief, mRNA was purified from total RNA using poly-T oligo-attached magnetic beads, fragmented and used for cDNA synthesis with random hexamer primer (NEB). .. After end repair, adenylation, adapter ligation, cDNA purification, and PCR amplification, 21 paired-end cDNA libraries were constructed, and their qualities assessed on the Agilent Bioanalyzer 2100 system.

    Article Title: The regulatory architecture of the primed pluripotent cell state
    Article Snippet: The eluted sample was further purified using AMPure XP PCR purification beads (Beckman Coulter A63880) at a 1:1 sample to bead ratio, and eluted with 15 μl of nuclease-free water. .. For second-strand synthesis, 1 μl of 10 mM dNTPs and 1 μl of 100 mM adapter-linked random hexamer primer were added, followed by heating at 70°C for 2 min and immediate cooling on ice for 5 min. 2 μl of NEBuffer 2 (New England Biolabs B7002) and 1 μl of Klenow large fragment DNA polymerase (New England Biolabs M0210) were then added, followed by incubation at 25 degrees for 30 min and two rounds of purification with AMPure XP beads. .. The double-stranded cDNA was eluted into 15 μl nuclease-free water and concentration measured using a Qubit Fluorometer 3.0 with dsDNA high-sensitivity assay kit (ThermoFisher Q32851).

    Magnetic Beads:

    Article Title: Full-length transcriptome sequences of ephemeral plant Arabidopsis pumila provides insight into gene expression dynamics during continuous salt stress
    Article Snippet: Sequencing libraries were generated using a NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB) following the manufacturer’s recommendations, and index codes were added to attribute sequences to each sample. .. In brief, mRNA was purified from total RNA using poly-T oligo-attached magnetic beads, fragmented and used for cDNA synthesis with random hexamer primer (NEB). .. After end repair, adenylation, adapter ligation, cDNA purification, and PCR amplification, 21 paired-end cDNA libraries were constructed, and their qualities assessed on the Agilent Bioanalyzer 2100 system.

    Incubation:

    Article Title: The regulatory architecture of the primed pluripotent cell state
    Article Snippet: The eluted sample was further purified using AMPure XP PCR purification beads (Beckman Coulter A63880) at a 1:1 sample to bead ratio, and eluted with 15 μl of nuclease-free water. .. For second-strand synthesis, 1 μl of 10 mM dNTPs and 1 μl of 100 mM adapter-linked random hexamer primer were added, followed by heating at 70°C for 2 min and immediate cooling on ice for 5 min. 2 μl of NEBuffer 2 (New England Biolabs B7002) and 1 μl of Klenow large fragment DNA polymerase (New England Biolabs M0210) were then added, followed by incubation at 25 degrees for 30 min and two rounds of purification with AMPure XP beads. .. The double-stranded cDNA was eluted into 15 μl nuclease-free water and concentration measured using a Qubit Fluorometer 3.0 with dsDNA high-sensitivity assay kit (ThermoFisher Q32851).

    DNA Synthesis:

    Article Title: Viral Metagenomics Revealed a Novel Cardiovirus in Feces of Wild Rats.
    Article Snippet: Background/Aims: Cardiovirus is a genus of viruses belonging to the family Picornaviridae.. Here, we used viral metagenomic techniques to detect the viral nucleic acid in the fecal samples from wild rats in Zhenjiang city in China.. Method: Fecal samples were collected from 20 wild rats and pooled into four sample pools and then subjected to libraries construction which were then sequenced on Illumina MiSeq platform.

    Sequencing:

    Article Title: Molecular and clinical characteristics related to rhinovirus infection in Brasília, Brazil
    Article Snippet: .. This primer pair was used to amplify an approximately 540-bp fragment for amplicon sequencing, including part of 5’ UTR and the VP4/VP2 protein gene of HRV A, B, and C. cDNA of the selected samples were synthesized using MMLV transcriptase (Thermo Fisher Scientific, Waltham, USA) with random hexamer primer and, then, amplified with LongAmp Taq DNA Polymerase (New England BioLabs, Ipswich, USA). .. The PCR product was purified and sequenced by the Sanger method at Macrogen Inc. (Seoul, South Korea).



    Similar Products

    96
    TaKaRa random hexamer primer
    Random Hexamer Primer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hexamer+primer/Random+Primer/pm41941638-281-16-19
    Average 96 stars, based on 1 article reviews
    random hexamer primer - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    97
    Qiagen random hexamer primers
    Random Hexamer Primers, supplied by Qiagen, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hexamer+primer/Random+Hexamers/pm42068851-57-30-35
    Average 97 stars, based on 1 article reviews
    random hexamer primers - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    99
    Bio-Rad random hexamer nucleotide rh primers
    Random Hexamer Nucleotide Rh Primers, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hexamer+primer/iScript+cDNA+Synthesis+Kit/pm41863601-118-12-21
    Average 99 stars, based on 1 article reviews
    random hexamer nucleotide rh primers - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    96
    TaKaRa random hexamers
    Random Hexamers, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hexamer+primer/Random+Primer/pm41839252-64-11-17
    Average 96 stars, based on 1 article reviews
    random hexamers - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    86
    Kaneka Corp random hexamer primers
    Random Hexamer Primers, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hexamer+primer/hexamer+primers+random/pm41754085-83-79-82
    Average 86 stars, based on 1 article reviews
    random hexamer primers - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    96
    TaKaRa random hexamer oligo dt primers
    Random Hexamer Oligo Dt Primers, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hexamer+primer/Random+Primer/pm41692694-63-21-25
    Average 96 stars, based on 1 article reviews
    random hexamer oligo dt primers - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    94
    New England Biolabs random hexamers
    Random Hexamers, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hexamer+primer/Random+Primer+6/pmc12875486-304-33-35
    Average 94 stars, based on 1 article reviews
    random hexamers - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results